pISSN : 2383-6415   eISSN : 2383-6423


고지방식이에 의한 말초 생체시계 유전자 발현 변화



서론

1. 연구의 필요성

비만은 각종 성인병을 유발하는 ‘질병’으로 세계보건기구(WHO)가 규정할 정도로 전 세계적 문제로 주목되고 있다. 비만의 원인은 여러 요인이 복합적으로 작용한다. 기본적으로 에너지 섭취와 소비의 불균형으로 지방이 축적되고, 부가적으로 바쁜 현대인들의 불규칙적인 식습관, 자동화로 인한 운동부족, 스트레스 같은 정신적 문제 그리고 일부 유전적인 원인 등이 영향을 미친다. 이와 함께 또 하나의 요인이 비만의 원인으로 주목을 받고 있다. 이 요인은 인간을 포함한 동물과 식물에서 24시간을 주기로 하는 생체리듬(circadian rhythm)으로, 체온조절, 호르몬 생성, 수면, 섭식 등과 같은 생물학적, 생리학적, 행동학적 활동에 관여한다[1, 2].

생체리듬은 일련의 생체시계 유전자의 조절에 의하여 이루어진다. 사람의 경우, circadian locomotor output cycles kaput (CLOCK), brain and muscle ARNT-like protein 1 (BMAL1), period 1-3 (PER1-3), Cryptochrome 1-2 (CRY 1-2), reverse erythroblastosis virus (REV-ERBα), 그리고 retinoid-related orphan receptor- (RORα)와 같은 생체시계의 유전자들이 소뇌, 중뇌, 시상하부와 같은 뇌조직 뿐 아니라 심장, 폐, 지방, 혈관, 신장과 같은 장기들에도 존재한다. 뇌 시상 하부의 시교차상핵(Suprachiasmatic Nucleus, SCN)에 존재하는 신경세포에 존재하는 생체시계 유전자들은 각 조직세포의 고유한 리듬을 동기화(synchronization)시켜 개체의 행동양상을 조절하는 중추시계(central Clock)의 기능을 하는 반면, 각 조직에 존재하는 유전자들은 말초시계(peripheral Clock)로 작용하여 호르몬과 신경전달물질을 통해 장기의 활동을 시간의 흐름에 따라 조절하는 것이 밝혀졌다[3].

이 생체시계의 교란에 의해 비만과 신진대사의 장애가 일어나는 대사증후군의 위험을 증가시킨다는 사실이 입증되었다. Turek (2005)의 연구에 의하면, 생체시계 유전자 중 하나인 Clock에 돌연변이가 일어난 생쥐들에게 24시간 생체주기의 교란이 일어나면서 체중과 먹이의 섭취가 증가하고 혈당 및 혈중 콜레스테롤(cholesterol)과 트리글리세리드(triglycerides, TG)가 증가하는 대사증후군의 증상이 일어났음을 보고하였다[4]. 한편, 유전자 Period의 발현이 억제된 생쥐(period knockout mice)를 낮과 밤의 주기가 12시간(정상), 4시간 또는 18시간 간격으로 조정된 세 가지의 조건에서 사육하였을 때 정상생쥐에 비하여 행동력이 감퇴되고 섭식이 증가되는 것을 관찰하였다[5]. 이는 낮과 밤의 주기가 생체시계 유전자와 상호작용이 일어나며 생체시계의 교란이 생리적, 병리적 변화를 일으킬 수 있음을 보여주는 결과이다. 현대에는 생활습관과 환경의 영향으로 일주기리듬의 교란이 발생하는 예가 많아지고 있다. 특히 깨어있는 시간이 길어지고 교대근무자들과 같이 낮과 밤이 뒤바뀌는 현상이 빈번하게 일어나고 있어 이러한 사람들은 수면부족과 피로, 호르몬이 연관된 질환에 이환되는 확률이 높아지고 있다[6]. 뿐만 아니라 각 조직에서는 말초 생체시계 유전자의 발현이 붕괴되고 지방세포의 지방대사, 췌장의 인슐린 분비, 간과 근육의 당대사, 장내 소화흡수 및 면역세포의 기능을 상실하여 결국 에너지 항상성의 교란이 일어나고 대사성 질환을 일으키는 결과가 발생하는 사례들이 보고되고 있다[7]. 또한 생체시계의 교란은 수명을 단축시키는 결과도 가져오기 때문에[5] 적절한 낮과 밤의 주기에 따른 생체시계의 조절이 정상적인 생리현상을 유지하고 질병의 발생을 감소시킬 수 있는 중요한 요인이라 하겠다.

현대사회에서 점차 증가하는 스트레스는 비만을 유발하는 요인으로 지목되었다. 스트레스에 노출되면 항상성을 유지하기 위해 교감 신경에 의한 자율신경계 반응과 시상하부-뇌하수체-부신(HPA axis)에 의한 중추신경계 반응이 일어나고 신체의 여러 기관에서 특이적 적응 반응들이 활성화된다. 이런 반응은 에피네프린(epinephrine), 노어에피네프린(norepinephrine) 그리고 코티솔(cortisol)의 분비를 촉진시킨다. 교감신경계에서 분비되는 카테콜라민(catecholamine)은 대항회피반응(fight-or-flight response)을 유도하며, 이때 심박동 증가, 혈압상승과 같은 신체적 변화가 일어난다. 만성 스트레스에 노출되어 코티솔 같은 글루코코르티코이드(glucocorticoid)가 과분비되면 대사과정 이상, 소화기계 이상, 면역학적 이상, 정신적인 장애 등이 발생하고, 이로 인해 대사증후군, 고혈압, 심장질환 등의 질병이 유발될 가능성이 높아진다[8].

생쥐에게 고지방식이를 공급하여 비만 발생을 유도하는 실험 모델은 비만, 당뇨, 고지혈증과 대사증후군을 연구하기 위하여 자주 이용된다[9]. 생쥐에게 45% 고지방식이를 공급하는 경우 16주 이후부터, 60% 고지방식이를 공급하는 경우에는 8주 이후부터 혈중 포도당, 지질 지표와 함께 인슐린 저항성이 일어난다. 본 연구는 고지방 함유량이 다른 식이를 주어 생쥐에게 장, 단기적으로 나타나는 체중의 변화, 섭식, 비만 및 대사증후군과 연관된 유전자의 변화와 함께 생체시계 유전자들이 비만에 의해 어떻게 변화하는지 살펴보고 고지방식이를 섭취한 생쥐에게 부동 스트레스를 가하여 비만의 진행이 가속화 될 수 있는지, 그리고 비만의 진행이 대사관련 유전자와 생체시계 유전자의 변화를 유도하는지 알아보고자 하였다.

2. 연구 목적

본 연구는 생쥐 동물모델에 고지방식이를 공급하여 비만을 유도한 후 비만이 발생하는 과정에서 식이 내 고지방 함유율의 차이에 따른 유전자의 발현, 그리고 스트레스 적용을 한 경우 변화하는 유전자 발현을 확인하고자 하였다. 구체적 목적은 다음과 같다.

1) 45%와 60%의 지방함유율이 다른 식이를 공급한 생쥐의 체중, 혈당, 혈청지질, 식이효율 등 생리학적 변화를 측정한다.

2) 비만이 발생하는 과정에서 지방함유율의 차이에 따른 대사관련 유전자의 변화를 파악한다.

3) 비만이 발생하는 과정에서 말초 생체시계 유전자의 변화를 파악한다.

4) 스트레스의 적용이 비만을 가속화하는지 살펴보고 대사관련 유전자와 말초 생체시계 유전자의 변화를 유도하는지 파악한다.

연구 방법

1. 연구설계

본 연구는 생쥐 동물모델을 이용하여 고지방식이의 지방 함유율에 따른 생리학적 변화와 대사관련 유전자 발현 정도, 그리고 말초 생체시계 발현의 변화를 측정한 실험연구이다. 또한 스트레스 노출에 의하여 비만 정도의 변화를 알아본 실험연구이다.

2. 연구대상

실험동물은 6주령의 C57BL/6J (중앙실험동물, Korea) 마우스를 1주일간 일반 고형사료로 사육하면서 환경에 적응시켰다. 실험동물은 물과 사료를 충분히 공급하였으며(ad libitum), 사육조건은 온도 23±1°C, 습도 50±5%, 낮과 밤의 주기는 12시간으로 조절하였다. 1주일간의 적응기간을 거친 생쥐는 기본 체중을 측정한 후 무작위로 각 실험군에 배정하였다. 지방함유량의 차이에 따른 실험은 8주 사육하였으며, 스트레스 적용을 위한 실험은 16주간 사육하는 총 여섯 그룹으로 나누었고, 탈락율을 고려하여 군 당 5마리 이상을 확보하였다. 실험의 전 과정은 Y대학교 동물윤리위원회의 승인(2013-0233)을 받은 후 규정에 따라 실시하였다.

3. 실험방법

1) 고지방식이의 공급

실험동물은 체중 측정을 한 후, 무작위로 ① 정상식이(Chow diet, CD), ② 45% 지방을 함유한 고지방식이(45% high fat diet, 45HFD), ③ 60% 지방을 함유한 고지방식이(60% high fat diet, 60HFD)를 공급받는 세 군으로 분류하여 총 8주간 사육하였다.

2) 스트레스의 적용

실험동물의 스트레스 모델은 부동 스트레스(immobilization stress)를 실시하였다. 3 cm×6 cm 간격으로 6칸의 아크릴 케이스를 제작한 후 뚜껑에 통풍이 잘 되도록 작은 구멍을 여러 개 뚫어주었다[10]. 스트레스 적용은 45HFD군에게 16주 동안 매일 오전 10시에 2시간씩 각 케이스에 넣는 방법으로 시행하였으며(45HFD+St), 대조군인 CD, 45HFD는 물과 먹이만 빼고 자유롭게 두었다.

3) 체중 및 식이효율 측정

실험식이를 공급한 후 1주일 간격으로 매 회 일정한 시간에 동물용 체중계(KC-500, CAS science, Daejeon, Korea)로 측정하였다. 공복혈당 측정을 위하여 전날 저녁부터 16시간동안 금식시킨 후 다음 날 오전에 꼬리말초혈관으로부터 소량의 혈액을 채취하여 ACCU-CHEK performa (Roche, Mannheim, Germany)으로 측정하였다. 식이는 매주 동일한 시간에 공급하였고 남은 사료의 양과 그날 공급한 사료의 양을 매주 측정하여 그 차이로 섭취한 식이량을 계산 하였다. 식이효율(food efficiency ratio, FER)은 실험 기간에 증가한 체중 증가량을 같은 기간 동안에 섭취한 총식이량으로 나누어 산출하였고 식이효율 산출공식은 아래와 같다[11].

FER = body weight change (g) / food intake (g)

4) 채혈 및 장기 적출

실험동물은 8주 후와 16주 후, 16시간 금식시킨 후 Zoletil50 (VirbacKorea, Seoul, Korea) (30 mg/kg)과 Rompun (BayerKorea, Seoul, Korea) (10 mg/kg)을 복강 주사하여 마취 후 개복하였다. 복부를 개복한 후 멸균 주사기를 사용하여 심장에서 혈액을 채취한 후 헤파린으로 처리한 멸균튜브에 모아 실험에 이용하였다. 채취한 혈액은 13,000 rpm (4°C)에서 10분간 원심분리 후 상층액을 새 튜브에 옮겨 -80 °C에 보관하였다. 간과 복강 내 지방은 적출하여 각 조직의 무게를 측정하고 튜브에 담아 액체질소에 급냉 시킨 후 -80 °C에 보관하였다.

5) 생화학적 검사

혈중 트리글리세리드 (ETGA-200, BioAssaySystems, Hayward, CA, USA), 총 콜레스테롤 (K623-100, Biovision, Milpitas, CA, USA)는 colorimetric assay로 측정하였고, 코르티코스테론(corticosterone) (CSB-E0769m, Cusabio, Wuhan, China), Leptin (K0331250P, KomaBio, Seoul, Korea) 및 인슐린(EZRMI-13K, Millipore, Billerica MA, USA)은 효소면역측정법(Enzyme-Linked ImmunoSorbent Assay, ELISA)을 이용하여 microplate reader (VersaMax ELISA Microplate Reader, Molecular Devices, Sunnyvale, CA, USA)로 490 nm에서 OD값을 구한 후 설명서에 나오는 방법에 근거하여 측정하였다.

6) 경구당부하검사(Oral Glucose Tolerance Test, OGTT)

16주 사육이 끝난 후 실험동물을 16시간 금식시킨 후 꼬리말초혈관에서 공복상태의 혈액을 채취하였다. 각 군에 2 g/kg의 포도당 용액(Sigma Aldrich, St. Louis, MO, USA)을 경구투여(gavage)한 후 30, 60, 90, 120분 경과 시 꼬리정맥으로부터 채혈하여 혈당의 농도 변화를 측정하였다.

7) 지방조직과 간에서의 RT-PCR 분석

각 100mg의 지방조직과 간으로부터 RNA는 RNeasy Mini Kit (Qiagen, Hilden, Germany)를 이용하여 분리하였다. Nanodrop (nanodrop 2000C, Thermo Scientific, Wilmington, DE, USA)으로 정량 후 1 μg의 total RNA를 RNA로 Maxime RT premix kit (Intron, Seoul, Korea)를 사용하여 cDNA를 합성하였다. 합성한 cDNA (45 ng)는 primer, SYBR premix Ex Taq (TaKaRa Bio Inc., Shiga, Japan)과 혼합하여 반응시켰다. 반응과정은 변성반응(95°C) 10초, 결합반응(50-60°C) 5초, 연장반응(72°C)초로 40회 반복하였다. 모든 반응은 3중반복실험을 하였으며 대조유전자로 glyceraldehyde-3-phosphate (GAPDH)를 사용하였다. mRNA 데이터는 각각의 산출된 threshold cycle (Ct)값 중 GAPDH에서 각각의 측정한 유전자의 Ct값을 뺀 차이값(ΔCt)에서 C57BL/6J의 발현값을 기준으로 하여 ΔΔCt 값을 구한 후 2-(ΔΔCt) 의 수치로 발현량을 계산하였다. 각 유전자의 primer 서열은 NCBI nucleotide sequence database의 유전자 서열 정보를 통해 primer를 디자인 하였다. Primer들의 유전자 서열은 Table 1과 같다.

Table 1

Primers list

Group Gene Symbol Name Primer Tm (°C)
Lipogenesis Acc Acetyl-Coenzyme A carboxylase alpha FW : GAAGTCAGAGCCACGGCACA 62
Rev : GGCAATCTCAGTTCAAGCCAGTC
Fas Fatty acid synthase FW : AGCACTGCCTTCGGTTCAGTC 62
Rev : AAGAGCTGTGGAGGCCACTTG
Srebf1 Sterol regulatory element-binding protein 1 FW : GGTACCTGCGGGACAGCTTA 60
Rev : CCGTGAGCTACCTGGACTGAA
Lipolysis Atgl Adipose Triglyceride Lipase FW : ATTTATCCCGGTGTACTGTG 60
Rev : GGGACACTGTGATGGTATTC
Lipe Hormone sensitive Lipase FW : TCCTGGAACTAAGTGGACGCAAG 60
Rev : CAGACACACTCCTGCGCATAGAC
β-Oxidation Acadl Long-chain acyl-CoA dehydrogenase FW : CTACCTCATGCAAGAGCTTCCACA 60
Rev : CTTCAAACATGAACTCACAGGCAGA
Acox1 Acyl-coenzyme A oxidase 1 FW : TTACATGCCTTTGTTGTCCCTATC 60
Rev : CGGTAATTGTCCATCTTCAGGTA
Cpt1a Carnitine palmitoyltransferase 1a FW : GAAGCCTTTGGGTGGATATGTGA 60
Rev : ATGGAACTGGTGGCCAATGA
Hadha hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase FW : GTGGTGTACCAGGATGCGAAAG 60
Rev : CCAGGATGAGCATGCCAAGA
Ppara Peroxisome Proliferator Activated Receptor Alpha FW : CCAATGTCCTGGCCACATTTC 60
Rev : GCCTGTCCTCAGGTGTGTCTGTA
W-Oxidation Cyp2e1 Cytochrome P450 2E1 FW : ACTGCTAAGGAGGATTTCACTCT 58
Rev : CTCATCCAGGTATCGATCATATT
Glucose metabolism Creb1 CAMP Responsive Element Binding Protein 1 FW : CCATTCTACAGTATGCACAGACCAC 60
Rev : TGGTATGTTTGTACATCGCCTGA
Foxo1 Forkhead box protein O1 FW : CAGACAGCCCGTCAGGATAGA 64
Rev : TTCTCAGATAGCAATGGAACAGGA
G6pc Glucose-6-phosphatase catalytic subunit FW : TGTCACGAATCTACCTTGCTGCTC 62
Rev : TATAGATGCTGTGGATGTGGCTGAA
Glut4 Glucose transporter type 4 FW : GCTTTGTGGCCTTCTTTGAG 60
Rev : CAGGAGGACGGCAAATAGAA
Pck1 Phosphoenolpyruvate Carboxykinase 1 FW : GGCATTATCTTTGGAGGCCGTAG 60
Rev : GCCAGGTATTTGCCGAAGTTGTAG
Pygl Liver glycogen phosphorylase FW : ACCTCTGTGGCAGAAGTGGTGA 60
Rev : CCGATAGGTCTGTGGCTGGAA
Hormone Hsd11b1 11β-hydroxysteroid dehydrogenase type 1 FW : ATGACCCAGCCTATGATTGC 60
Rev : GAGGCCAAGGACACAGAGAG
Lep Leptin FW : CCAGGATCAATGACATTTCACACAC 60
Rev : AGGTCATTGGCTATCTGCAGCAC
Nr3c1 Nuclear receptor subfamily 3, group C, member 1 FW : AAGCAGGGACGACAATTCVAG 60
Rev : CTAAAGCTCCCGAAGGCTACCA
Inflammation Il6 Interleukin 6 FW : CCACTTCACAAGTCGGAGGCTTA 58
Rev : GCAAGTGCATCATCGTTGTTCATAC
Tnf Tumor necrosis factor FW : AAGCCTGTAGCCCACGTCGTA 58
Rev : GGCACCACTAGTTGGTTGTCTTTG
Ucp2 Uncoupling protein 2 FW : GCAAGCATGTGTATGGCACAGTAA 60
Rev : AAATGTGGGCCTTCGGTCAG
Circadian gene Arntl Aryl hydrocarbon receptor nuclear translocator-like FW :CTACGAAGTCGATGGTTCAGTTTCA 60
Rev : AGCATGCTGTCCATGCTGTG
Clock Circadian locomotor output cycles kaput FW : TGAACGGGAAGCTCACTGG 60
Rev : TCCACCACCCTGTTGCTGTA
Cry1 Cryptochrome 1 FW : GGAGATGCCAGCAGACACCATC 60
Rev : CGTTCAAAGTTTGCCACCCAGGC
Per1 Period circadian clock 1 FW : GGGAGCTCAAACTTCGACTG 60
Rev : GGTTAGCCTGAACCTGCTTG
Per2 Period circadian clock 2 FW : CCCAGCTTTACCTGCAGAAG 60
Rev : CCAACATGGTCGAAAGGAAG
Per3 Period circadian clock 3 FW : CTGTATTATGCCAGGCTTGATTTGA 60
Rev : CAGAGATTGCCGGTGTACTGATG
Reference gene Gapdh Glyceraldehyde 3-phosphate dehydrogenase FW : TGAACGGGAAGCTCACTGG 58
Rev : TCCACCACCCTGTTGCTGTA 64

8) 통계분석

실험결과는 평균과 표준편차로 나타내었고, 유의성 검정을 위해서 Prism 5.0 (GraphPad Software, La Jolla, CA, USA)를 이용하여 one-way ANOVA (analysis of variance) 분석을 실시하고 Tukey’s multiple comparison test에 의해 p<0.05의 수준에서 사후 검정하였다.

연구 결과

1. 체중증가, 식이섭취량, 식이효율과 생화학적 지표의 변화

실험기간 동안의 체중변화, 식이섭취량과 식이효율값은 Table 2와 같다. 비만 유도 전 6주령 생쥐의 평균체중은 17.3±0.8g 이었으나 8주의 실험기간 동안 45%와 60% 고지방식이 실험군(45HFD, 60HFD)들은 정상식이군(CD군)에 비하여 체중이 유의하게 증가하였다. 생쥐의 총 식이섭취량은 CD군이 가장 많고 60HFD군이 유의하게 적게 섭취하였으나(F=21.04, p=.001), 반대로 식이효율은 CD군이 가장 낮고, 45HFD군이 다음으로 높았으며, 60HFD군이 가장 높은 것으로 나타났다(F=6.85, p=.016). 이는 식이섭취량이 적더라도 과도한 지방의 섭취와 함께 효율적으로 에너지를 소모하는 능력이 떨어져 체중이 증가하였음을 의미한다.

Table 2

Effect of High Fat Diet for 8 Weeks (N=18)

Dependent variables Group F p
CD (n=6) 45HFD (n=6) 60HFD (n=6)
Weight (g) 21.7±0.5 22.7±2.3 25.0±1.0* 5.88 .015
Weight gain (g) 3.5±0.6 5.9±2.8 7.7±1.2* 5.46 .028
Food intake (g) 33.2±0.3 33.0±6.0 26.3±1.3***,### 21.04 <.001
FER 0.112±0.020 0.220±0.104 0.313±0.049* 6.85 .016
Blood glucose (mg/dL) 154.4±9.0 155.5±32.3 170.6±5.7* 4.11 .041
TG (mg/dL) 118.8±32.2 178.9±34.4* 158.3±6.8 4.79 .035
TC (mg/dL) 55.3±4.7 65.5±2.9 137.4±14.6***,### 110.7 <.001
Insulin (ng/mL) 0.130±0.028 0.199±0.036 2.111±0.271***,### 217.8 <.001
Leptin (ng/mL) 3.9±1.3 24.2±3.1*** 83.9±10.6***,### 199.5 <.001

CD=chaw diet; HFD=high fat diet; FER=food efficiency ratio; TG=triglyceride; TC=total cholesterol;

* =p<.05 vs CD;

*** =p<.005 vs CD;

### =p<.005 vs 45HFD.

실험 8주 후 16시간 금식시킨 후 혈중 생화학적 지표들을 분석하였다. 혈중 트리글리세리드, 총 콜레스테롤, 인슐린과 렙틴의 수치 모두 식이의 지방 함유량이 높을수록 유의하게 증가하였고 혈중 트리글리세리드, 렙틴의 수치는 정상식이에 대해 45HFD군에서도 유의하게 증가하였다. 한편, 식이에 의한 혈당차이는 60HFD군에서만 유의한 증가를 보였다(F=4.11, p=.041).

스트레스가 비만의 발생과 진행에 영향을 끼치는지 알아보기 위하여 CD군에 비하여 큰 변화가 일어나지 않은 45HFD군에게 부동 스트레스를 적용(45HFD+St)한 후, 비만의 진행에 영향을 미치는지 조사하였다. 매일 2시간씩 16주간 부동스트레스를 적용한 결과는 다음과 같다(Table 3). 16주간 45%의 고지방식이를 계속 투여한 결과 CD군에 비하여 체중, 식이섭취량과 생화학적 지표들이 지속적으로 증가하였다. 그러나 부동 스트레스는 체중증가에 큰 차이를 보이지 않았다. 식이섭취량은 45HFD군에 비해 유의하게 감소하였으나 오히려 식이효율은 증가하는 양상을 보이나 통계적으로 유의하지는 않았다. 혈당, 혈중 트리글리세리드, 총 콜레스테롤, 인슐린과 렙틴은 45HFD군에서 유의하게 증가하였으나 45HFD+St군과는 차이가 없었다. 위의 결과들을 종합할 때, 스트레스의 적용이 렙틴의 증가와 식이섭취량을 감소시키지만 상대적으로 식이효율을 증가시킴으로써 에너지 대사가 원활하지 않음을 나타내고 있다. 또한 지방의 함유량이 낮더라도 지속적인 섭취는 고혈당, 고지혈증, 고인슐린혈증 등 사람의 대사증후군에서 나타나는 증상이 일어났음을 보여주고 있다. 혈중 코르티코스테론의 수치는 세 군 모두 유의한 변화가 없었다.

Table 3

Effect of High Fat Diet and Immobilization Stress for 16 Weeks (N=18)

Dependent variables Group F p
CD (n=6) 45HFD (n=6) 45HFD+St (n=6)
Weight (g) 24.0±1.5 29.4±3.9 29.4±4.3 2.42 .131
Weight gain (g) 5.8±1.8 12.6±4.5 12.4±5.0 3.69 .068
Food intake (g) 66.4±0.6 57.4±11.6* 50.6±11.0*** 11.91 <.001
FER 0.097±0.031 0.266±0.100 0.303±0.127 3.07 .096
Blood glucose (mg/dL) 135.3±9.0 162.5±9.9* 149.2±16.0 5.04 .028
TG (mg/dL) 117.5±5.2 159.9±23.9 155.7±29.0 3.33 .071
TC (mg/dL) 65.1±5.1 81.4±8.3* 86.7±6.1** 8.41 .007
Insulin (ng/mL) 0.179±0.057 0.285±0.037 0.211±0.045 1.80 .207
Leptin (ng/mL) 4.6±4.2 40.9±5.2*** 43.4±3.8*** 100.5 <.001
Corticosterone (ng/mL) 66.9±6.0 60.7±12.8 66.5±7.2 0.51 .617

CD=chaw diet; HFD=high fat diet; St=stress; FER=food efficiency ratio; TG=triglyceride; TC=total cholesterol;

* =p<.05 vs CD;

** =p<.01 vs CD

*** =p<.005 vs CD.

고지방식이와 스트레스가 당불내성에 미치는 영향을 측정하기 위해 경구당부하검사(OGTT)를 실시하였다 (Fig. 1A). 경구당부하검사 결과, 60HFD군의 혈중포도당 농도가 CD군, 45HFD군, 그리고 45HFD+St군에 비해 관찰한 모든 시간대에서 높을 뿐만 아니라(Fig. 1A), 120분간의 총포도당농도변화량(Area under the curve, AUC)도 유의하게 높은 것으로 나타났다(Fig. 1B). 또한 인슐린 투여(0.75 U/kg) 후 2시간 동안의 혈중포도당 농도를 측정하는 인슐린 내성 실험(ITT)을 시행하였으나 60HFD군에서만 초기 30-60분에서 인슐린 내성을 보여 당불내성의 결과에 대한 일관성을 보였으나 다른 군에서는 유의한 차이를 보이지 않았다(결과 생략).

Fig. 1

Glucose tolerance test (GTT) and insulin tolerance test (ITT) in high fat diet-induced mice. (A) Results of the oral glucose tolerance test (OGTT) at 16 week of age showed elevated blood glucose levels in 60% high fat diet-induced mice (60HFD). (B) Area under the curve (AUC) of OGTT. (C) Results of the insulin tolerance test showed attenuated insulin responses in 60% high fat diet-induced mice. Chow diet (CD), 45% high fat diet (45HFD) or 45% high fat diet with stress (45HFD+St) shows no differences among groups. (D) Area under the curve (AUC) of ITT.

*p<.05; **p<.01; ***p<.001 compared with CD; CD=chow diet; 45HFD=45% high fat diet; 60HFD=60% high fat diet; 45HFD+St=45% high fat diet with stress.

JKBNS_18_305_fig_1.jpg

2. 식이에 따른 지방조직 내 유전자의 변화

고지방식이에 의한 지방대사를 알아보기 위하여 각 군의 내장지방과 간을 적출한 뒤 관련 유전자들의 mRNA 발현 정도를 RT-PCR을 이용하여 조사하였다(Fig. 2). 지방대사는 크게 지방의 합성(lipogenesis)과 지방의 분해(lipolysis)로 구분한다. 모든 군의 지방조직에서 지방합성효소인 acetyl-CoA carboxylase (Acc)와 fatty acid synthase (Fas)의 mRNA 발현은 유의한 차이가 없었다. 그러나 지방분해 효소인 hormone sensitive lipase (Lipe)와 adipose triglyceride lipase (Atgl)의 mRNA 발현은 60HFD군에서 유의하게 증가하므로(Fig. 2A) 이는 고지방식이섭취에 따라 지방분해효소의 생성 또한 증가시키는 것을 시사한다. 한편, 코르티코스테론의 수용체인 nuclear receptor subfamily 3, group C, member 1 (Nr3c1) 과 그의 활성 효소인 11 beta-hydroxysteroid dehydrogenase type 1 (Hsd11b1)의 발현이 60HFD군에서 유의하게 증가하였다. Table 2의 혈중 렙틴의 수치가 증가하는 것과 마찬가지로 지방세포 내 렙틴의 mRNA 수치 역시 지방함유율이 높을수록 증가하였다(Fig. 2B).

Fig. 2

High fat diet alters mRNA expressions of metabolic genes in fat tissue and liver. Mice were fed with chow or high fat diet (45% or 60%) for 8 weeks. mRNA expression was determined by real-rime PCR in fat tissue (A-C) and in liver (D-I). Values were expressed as the means±SD standard deviation (SD) after normalization to Gapdh.

*p<.05, **p<.01 and ***p<.001 versus CD, #p<.05, ##p<.01 and ###p<.001 versus 45HFD; CD=chow diet; 45HFD=45% high fat diet; 60HFD=60% high fat diet.

JKBNS_18_305_fig_2.jpg

지방의 축적은 조직 내 염증반응을 증가시키는 것으로 알려져 있다[12]. 지방조직 내 주요 염증성 물질의 발현여부를 측정한 결과, tumor Necrosis Factor (Tnf)가 고지방식이군들에서 증가하는 양상을 보였으나 유의하지는 않았으며 염증반응과 지질 산화와 연관성이 있는 uncoupled protein-2 (Ucp2)는 고지방식이의 지방함유량이 높을수록 유의하게 증가하였다(Fig. 2C).

3. 식이에 따른 간조직 내 유전자의 변화

간조직 내 지방대사의 유전자 발현은 지방조직과는 다른 양상으로 나타났다. 45HFD군 간조직의 AccFas, 그리고 이들 유전자의 전사인자인 sterol regulatory element transcription factor (Srebf1)의 발현이 증가하는 반면, Atgl과 같이 지방 분해에 관련된 유전자의 발현은 유의하게 감소하였는데(Fig. 2D), 이는 고지방식이에 따라 간에 지방을 합성하고 축적하는 과정으로 보인다. 지방은 베타 산화과정(β-oxidation)을 통하여 지방을 분해하여 에너지원으로 전환하는데 이때, 지방산을 미토콘드리아로 전달하여 주는 carnitine palmitoyltransferase 1a (Cpt1a)의 발현이 두 고지방식이군에서 감소하고, long-chain L-3-hydroxyacyl-coenzyme A dehydrogenase (HADHα), acyl-Coenzyme A dehydrogenase, long-chain (Acadl), peroxisomal acyl-coenzyme A oxidase 1 (Acox1)과 같이 지방산의 산화과정에 관여하는 유전자의 발현에는 변화가 없었다. 특히, peroxisome proliferators-activated receptor (Ppara)의 mRNA 발현이 고지방식이군의 간조직에서 현저하게 떨어지는 것으로 보아 이는 지방산의 미토콘드리아 내 유입과 지방산 산화에 장애가 일어나는 것을 의미하며 이는 Ppara의 직접적인 타겟유전자인 Cpt1a 발현의 감소와도 일관성을 보이고 있다(Fig. 2E). 지방산의 베타 산화 관련 유전자들의 발현에 큰 변화가 일어나지 않는 반면, 미세소체(microsome)에 의한 오메가 산화(β-oxidation)에 관여하는 cytochrome P450 2E1 (Cyp2e1)의 발현은 고지방식이의 지방함유량이 높을수록 증가하였다(Fig. 2F). Fig. 2D-F의 결과를 종합하여 볼 때 고지방식이는 간조직내 지방의 합성을 증가하여 축적하지만 이를 에너지원으로 전환하여 소비시키는 미토콘드리아 내 베타 산화를 활성화시키지 못하고 과도한 지방산의 축적으로 일어나는 대체산화작용인 미세소체 내 오메가 산화가 일어나는 것을 시사한다.

간조직 내 당대사의 변화를 살펴보기 위하여 당신생과정 (glyconeogenesis)에 관여하는 유전자의 발현을 확인하였다. phosphoenolpyruvate carboxykinase 1 (Pck1)과 glucose-6-phosphatase (G6pc)의 발현은 고지방식이군에서 유의하게 감소하였고, 전사인자로 작용하는 cAMP responsive element binding protein 1 (Creb1) 또한 고지방식이군에서 감소하였다. 그러나 또 다른 전사인자인 forkhead box protein O1 (Foxo1)은 60HFD군에서 증가하였다. 간에서 글리코겐을 이용하여 당원분해과정(glycogenolysis)에 작용하는 유전자 liver glycogen phosphorylase (Pygl)의 발현 역시 고지방식이에서 유의하게 감소하였다(Fig. 2G).

한편, 간에서의 Nr3c1Hsd11b1은 지방조직과는 다른 양상을 보였다. Nr3c1은 45HFD군에서 유의한 증가를 보이다 60HFD군에서는 감소를 하였고, Hsd11b1은 모든 고지방식이군에서 현저하게 감소하였다(Fig. 2-H). Ucp2의 발현은 지방조직에서와 마찬가지로 60HFD군에서 증가하였으나 Il6Tnf의 경우 증가하는 경향이 나타나지만 유의한 차이를 보이지 않았다(Fig. 2I). 위의 결과를 종합하여 볼 때 고지방식이에 의한 간조직 내 지방의 합성은 적절한 미토콘드리아의 베타 산화를 저해하고 미세소체의 오메가 산화를 증가시키는 결과를 가져오며 혈중 포도당 수치가 증가함에 따라 당신생과정이나 당원분해과정은 억제되는 것을 알 수 있다.

4. 부동 스트레스(immobilization stress)에 의한 유전자 발현의 변화

45% 고지방식이와 함께 부동 스트레스에 16주 동안 노출 시켰을 때 유전자의 발현 변화를 비교, 확인하였다(Fig. 3). 지방조직에서 지방합성에 관여하는 유전자 AccFas의 발현은 45HFD군과 45HDS+St군 모두 유의하게 감소하였고, 지방분해와 관련된 유전자들이나 Glut4의 발현에는 차이가 없었다. 45HFD군에서 증가한 Nr3c1Hsd11b1의 발현은 스트레스적용에 의해 유의한 차이를 보이지 않으나 점차 발현이 증가하는 양상을 보였다(Fig. 3A). 렙틴의 유전자 발현은 CD군 대비 45HFD군에서 유의하게 증가하였으나 스트레스 적용이 큰 영향을 미치지 않은 것으로 보이며(Fig. 3B), 산화 스트레스에 관여하는 Ucp2와 염증 표지자인 Il6Tnf의 발현은 스트레스 적용을 받은 45HFD+St군에서 유의하게 감소하였는데, 이는 부동스트레스에 의한 Nr3c1Hsd11b1 유전자 발현의 증가가 조직 내 코티솔 활성을 높인 것으로 보이며 Il6Tnf의 감소는 코티솔 활성 증가에 의한 면역억제효과를 반영하는 것으로 보인다(Fig. 3C).

Fig. 3

Immobilization stress alters mRNA expressions of metabolic genes in fat tissue and liver. Physical immobilization was used to cause chronic stress. 45% high fat diet-induced mice received immobilization stress for 2 hr daily for 16 weeks. mRNA expression was determined by real-rime PCR in fat tissue (A-C) and in liver (D-I). Values were expressed as the means±SD standard deviation (SD) after normalization to Gapdh.

*p<.05, **p<.01 and ***p<.001 versus CD, #p<.05, ##p<.01 and ###p<.001 versus 45HFD; CD=chow diet; 45HFD=45% high fat diet; 60HFD=60% high fat diet.

JKBNS_18_305_fig_3.jpg

부동 스트레스의 적용은 간 조직 내 지방산의 산화과정에 영향을 주는 것으로 나타났다. 16주간 고지방식이를 섭취한 쥐의 간조직에서 지방의 합성과 분해는 Acc의 발현을 제외하고는 큰 변화가 없을 뿐 아니라, 지방합성의 주요 전사인자인 Srebf1의 발현이 스트레스 적용에 의해 감소되었음을 확인하였다(Fig. 3D). 이에 비하여 지방의 베타 산화와 오메가 산화는 더 활발히 일어나 Cpt1a, Acadl, Acox1의 발현이 유의하게 증가하였으며(Fig. 3E) Cyp2e1의 발현은 스트레스에 의하여 더 활성화 되는 것을 알 수 있었다(Fig. 2E, Fig. 2F). 당대사와 관련된 유전자들은 당신생과정과 당원분해과정 모두 8주 시점과 비교하여 큰 변화가 보이지 않았으며(Fig. 3G) 스트레스가 이러한 유전자들의 발현에 영향을 미치지 않았다. Nr3c1Hsd11b1 의 발현 역시 8주 시점과 차이가 나타나지 않았으며(Fig. 3H), 지방조직과는 달리 염증 사이토카인 Il6Tnf 그리고 Ucp2의 발현은 고지방식이나 스트레스에 의한 변화가 없었다(Fig. 3I).

5. 식이에 따른 생체시계 유전자 발현의 변화

본 연구는 고지방식이와 스트레스가 지방조직과 간조직의 생체시계 유전자의 발현에 변화를 일으키는지 유전자의 mRNA의 RT-PCR을 통하여 확인하였다(Fig. 4). 지방조직에서는 Clock, aryl hydrocarbon receptor nuclear translocator-like protein (Arntl;마우스의 BMAL1 유전자), Cry1, Per1, Per2, Per3 모두 고지방 함유량이 많을수록 mRNA의 발현이 증가하는 경향을 보였고 특히 Clock, ArntlPer2의 발현이 유의하게 증가하였다(Fig. 4A). 간조직 내의 생체시계 유전자의 발현 역시 고지방식이에 따라 변화가 있었는데 45HFD군에서 Clock, Cry1의 발현은 감소하고 Per 1-3의 발현은 증가하였다. 이는 Clock/Arntl 복합체(complex)가 Cry/Per의 복합체와 서로 상호작용하므로 이에 따른 변화인 것으로 보인다. 이러한 발현의 변화는 60HFD군에서 반대 양상을 보여 Clock, Arntl, Cry1의 발현이 증가하는 반면, Per1-3유전자의 발현은 지방 함유량이 높을수록(60HFD) 감소하였다(Fig. 4B).

Fig. 4

High fat diet and immobilization stress alters mRNA expression of circadian clock genes in fat and liver. mRNA expression of circadian clock genes in fat (A) and liver (B) at 8 weeks of age. mRNA expression of circadian clock genes in fat (A) and liver (B) at 16 weeks of age. Values were expressed as the means±SD standard deviation (SD) after normalization to Gapdh.

*p<.05, **p<.01 and ***p<.001 versus CD, #p<.05, ##p<.01 and ###p<.001 versus 45HFD; CD, chow diet; 45HFD, 45% high fat diet; 60HFD, 60% high fat diet; 45HFD+St, 45% high fat diet with stress.

JKBNS_18_305_fig_4.jpg

한편, 16주 동안 45% 고지방식이를 섭취하게 되면 8주와는 달리 지방조직의 대부분의 유전자 발현이 유의하게 증가하였다. 특히, 45HFD군의 Per1-3의 발현이 8주 시기에 비해 CD군과 비교하였을 때 차이가 크므로 고지방식이의 기간이 길수록 유전자들의 발현이 더 증가하는 것을 알 수 있다. 한 편, 스트레스를 적용하였을 때 지방 내 Arntl은 유의하게 증가한 반면, 그 외의 생체시계 유전자들의 발현은 스트레스에 의해 감소하는 것이 발견되었다(Fig. 4C).

간조직의 경우, 8주 시기와 유사하게 Clock/Arntl의 발현은 감소하고, Per1-3의 발현은 증가하였다. 45HFD+St군에서 ClockCry1의 발현에 유의한 변화가 있었으나 그 외의 유전자에는 큰 영향이 나타나지 않았으나(Fig. 4D). 45HFD+St군의 Per1-3의 발현이 60% HFD군에서와 같이 45HFD군에 비교하여 감소하는 것을 알 수 있었다(Fig. 4D). 한 가지 주목할 점은 지방조직은 Per2가, 간조직은 Per3의 발현에 큰 변화를 보여 장기나 조직에 따라 주요 역할을 하는 유전자가 다르게 작동하는 것으로 보인다.

논의

본 연구는 비만이 발생하였을 때 일어나는 대사성 변화를 보기 위하여 사람과 가장 유사하게 나타나는 C57BL/6J 마우스에게 보편적으로 사용하는 45%와 60% 고지방식이를 각각 공급하여 10%의 지방을 함유하고 있는 정상식이(CD)를 공급하였을 때와 어떤 변화가 일어나는지 비교, 분석하였다[13]. 지방함유량이 높거나 과도한 칼로리 섭취에 의해 비만이 발생하면 지방대사의 장애가 일어나면서 간조직에 과도한 지방이 축적이 되는 지방간증 또는 비알콜성 지방간질환의 발생이 증가하게 된다. 지방간의 증가 기전은 첫째, 식이 지방 혹은 칼로리의 과다 섭취에 의한 간으로 지방 유입(inflow)의 증가, 둘째, 지방조직(adipose tissue)에서 지방분해(lipolysis)의 증가로 인한 간으로의 과도한 유리지방산(free fatty acids)의 유입, 셋째, 간에서 신규 지방합성(de novo lipogenesis)의 증가, 넷째, 간에서 초저밀도콜레스테롤(Very Low Density Lipoprotein)을 통한 TG 유출(outflow)의 감소, 그리고 다섯째로 간에서 지방산 산화(oxidation)의 감소, 즉 공복 중 당신생(gluconeogenesis) 등의 주요 에너지원 사용의 감소 등이다[14]. 본 연구를 통해 나타난 결과들은 지방간이 발생하는 기전을 순차적으로 증명하고 있다. 45% 또는 60%의 고지방식이를 공급하고 8주가 지난 시점에 지방조직에서는 지방의 합성보다는 지방 분해에 관여하는 효소들, LipeAtgl의 발현이 유의하게 증가하였다. LipeAtgl은 지방조직에서 트리글리세리드를 다이아실글리세롤(diacylglycerol;DAG)과 유리지방산(free fatty acids)으로 분해하는 효소이다. 동시에 간에서는 지방생성의 전사요소(transcription factor)인 Srebf1을 통한 Fas, Acc와 같은 지질 합성 효소의 발현이 증가하고 그 결과로 혈중 지질 지표의 증가가 일어남을 확인하였다. 정상적인 대사과정에서 인슐린은 지방조직에서 지방 분해를 억제하지만 본 연구에서와 60HFD군에서는 혈중 인슐린은 증가하나 인슐린 저항성이 수반되면서 지방조직의 지질 분해가 촉진되고(Fig. 2A), 분해된 유리지방산은 간으로 유입되는 동시에 Srebf1의 유전자 발현을 증가시키는 것을 확인할 수 있었다[15]. 이러한 인슐린 저항성과 간에서 중성지방의 축적에 대한 Srebf1의 역할은 다른 동물모델을 통해서도 증명되었다. 고도비만과 인슐린 저항성의 특징인 ob/ob mice에서 지방간 병변이 관찰되었고, ob/ob mice의 Srebf1 유전자를 비활성화 시켰을 때 간조직에 중성지방의 축적이 약 50% 정도 감소함을 보고한 연구를 통해 Srebf1가 인슐린 저항성동물 모델에서 지방간의 발생에 중요한 역할을 담당함을 알 수 있다[16].

유리지방산은 베타 산화를 통하여 에너지원으로 전환되어야 하지만 본 연구의 결과와 같이 지나친 지방의 축적은 베타산화를 억제하고(Fig. 2E) Cyp2e1의 발현을 증가시켜 대체 산화과정을 일으키게 한다(Fig. 2F). 간세포의 지방산 산화효소인 Cyp2e1은 활성이 증가하면 간에 축적된 유리지방산으로부터 활성산소종을 생성시켜 산화스트레스를 일으키는 것으로 알려져있다[17]. 세포의 대사과정에서 미토콘드리아는 ATP를 생성하는 기능을 담당한다. 이 과정 중에 미토콘드리아는 생존적 반응으로 산소로 전자의 이동이 증가되어 활성산소종(reactive oxygen species, ROS)이 생성하는데, 지나친 ROS는 IL-6TNF를 포함한 여러 사이토카인의 전사인자인 NF-kB를 활성화시켜 미토콘드리아의 기능저해와 ROS 생성을 증가시키게 된다. 미토콘드리아 막에 존재하는 UCP2는 이러한 ROS의 생성을 억제하는 단백질로 비알콜성 지방간질환 (non-alcoholic fatty liver disease, NAFLD)과 비만에서 산화스트레스(oxidative stress)가 높을 때 발현이 증가한다고 보고되어있다[18]. 본 연구에서도 16주동안 45%의 고지방식이를 적용한 생쥐의 지방조직에서 Ucp2와 사이토카인(IL6, Tnf)의 증가를 확인할 수 있었는데(Fig. 3C), 이는 지방산에서 생성된 활성산소의 증가에 따라 증가한 일련의 반응이라 볼 수 있다.

본 연구에서 Lep, Nr3c1 그리고 Hsd11b1 세 가지 유전자는 식이의 고지방 함량에 따라 발현의 차이를 보였다. Lep은 지방세포에서 분비되는 호르몬 유전자로 정상식이를 하는 마우스에 비해 45HFD군에서 약 6배, 60HFD군에서는 약 21.5배의 mRNA 발현의 증가를 보인데 비해 식이 섭취량에는 큰 변화를 보이지 않은 것으로 보아 지방량의 증가를 간접적으로 나타내기도 하며[19, 20], 비만군에서 흔히 나타나는 렙틴 저항성의 결과로도 해석할 수 있다. 60HFD군에서 사료섭취량이 약 20% 감소하였으나 실제 렙틴의 저항성이 있는지는 렙틴 수용체를 포함하는 관련 호르몬의 발현과 분비에 대한 후속 조사가 필요할 것으로 보인다. 또한, 글루코코르티코이드는 비만과 비알콜성 지방간질환에 연관성이 있는 것으로 알려졌다. Andrews 등의 연구에 의하면 불활성형 코르티손(cortisone)을 활성형 코티솔(cortisol)로 변환시키는 효소인 Hsd11b1를 억제하면 체중 및 혈중 지질수치의 감소화 함께 간의 인슐린 저항성이 낮아진다고 보고하였다[21]. 이는 본 연구결과에서도 유사하게 나타나 고지방식이를 할수록 지방세포의 Hsd11b1의 발현과 함께 수용체인 Nr3c1 의 발현도 증가하는 것을 볼 수 있었다. 그러나 간조직에서 Hsd11b1의 발현은 현저하게 감소하고(Fig. 3H), 혈중 코르티코스테론의 수치에는 변화가 없는 것으로 볼 때, 전신적인 혈액 내 글루코코르티코이드와 조직에서 발현되는 호르몬의 양은 동일하지 않다는 점을 알 수 있다. 또한 각 조직마다 발현의 정도가 다르므로 이 호르몬에 의한 대사기능의 조절에 대해 앞으로 더 연구되어야 할 것이다. 또한, 인슐린저항성은 비만이나 제2형당뇨의 저등급 염증(low-grade inflammation) 상태에 의해 동반되어 염증 사이토카인을 분비시키고, 11βHSD1을 증가시켜 글루코코르티코이드를 활성화시킨다[22]. TNF 또는 dexamethasone이 쥐의 지방세포에서 인슐린저항성을 유도한다고 보고 되었다[23]. Foxo1은 인슐린 신호전달을 매개하는 전사조절인자로 인슐린 수용체를 제거한 유전자변형 쥐의 간에서 증가되었고, Foxo1을 제거하면 미토콘드리아의 산화 신진대사와 생합성 기능을 회복시켰다[24]. 본 연구 결과에서 나타난 Foxo1의 증가는 당대사와는 상관없이 미토콘드리아의 기능을 낮추는 것으로 보인다.

본 연구에서 고지방식이를 공급한 마우스들의 지방과 간 조직의 생체시계 유전자들의 발현은 지방 함량에 따라 증가하는 패턴을 보였다. 또한 16주령 45HFD군의 혈중 생화학 지표가 8주령 60HFD군의 지표들만큼 상승하였는데 생체시계 유전자들의 발현 정도가 동일하게 상승되는 것을 확인할 수 있었다. 단, 60HFD군의 간조직과 16주령 45HFD군 지방조직의 Per2, 3의 유전자 발현이 현저하게 감소하는 것으로 보아 유전자들의 아이소형(isoform)들이 각각 다른 기능을 가지고 있는 것으로 보이며 조직에 따라 유전자의 발현패턴과 조절인자가 다를 것을 예상할 수 있다. 지방세포의 주요 업무는 지방대사와 염증 사이토카인의 분비이며, ClockArntl은 고지방식이에 의한 지방대사의 활성을 조절하는 것으로 생각된다[25]. ClockArntl의 활성으로 증가된 CryPer 발현의 증가는 negative feedback에 의하여 ClockArntl의 발현을 억제하는 패턴을 보였다.

고지방식이로 유도하는 비만연구를 할 때 60%의 고지방 식이는 짧은 시간 내에 비만을 유도할 수 있어 일반적으로 쓰이는 방법이나 1 g 당 5.24 kcal로 232 mg의 콜레스테롤을 함유하고 있어 사람의 식이에 견주어 보면 현실적이라 보기 어렵고[9] 비만 발생의 정도가 이미 한계점을 도달한 상태이므로 본 연구에서는 45% 고지방식이로 중간 정도의 비만을 유도하고 이를 스트레스가 가속시킬 수 있는지 보고자 하였다. 부동 스트레스(immobilization stress) 모델은 만성 스트레스를 적용하는데 자주 쓰이는 방법으로 시상하부-뇌하수체-부신 축(hypothalamus-pituitary-adrenal axis)과 교감신경계(sympathetic nervous system)의 활성화를 특징으로 한다. Thaker 등의 연구에 의하면 특수 제작된 아크릴 케이스에 매일 2시간씩 감금된 마우스들의 스트레스 호르몬인 혈중 코르티코스테론은 실험 개시 3일부터 증가하기 시작하여 7일과 14일에는 대조군에 비교하여 유의하게 증가하였다. 그러나, 장기간의 스트레스 적용이 혈중 코르티코스테론을 지속적으로 높은 상태로 유지하지는 않는 것으로 보인다[10]. Voorhees의 연구에 따르면, 하루 6시간씩 부동 스트레스를 적용하였을 때 적용 초기인 7일에 가장 수치가 높았으나 이후 점차 감소하는 추세를 보였다[26]. 지속적인 스트레스가 장기적으로 적용되었음에도 불구하고 스트레스 호르몬이 감소하는 이유와 기전에 대해서는 알려진 바가 없으나 두 가지의 경우로 설명이 가능할 것으로 보인다. 첫째, 정상적인 스트레스 호르몬은 낮과 밤의 일주기에 따라 수치의 고저가 있는 일변화(diurnal cycle)를 가지는 반면, 장기적 스트레스가 적용됨에 따라 일변화의 주기가 단축 또는 지연이 될 가능성이 있다. 둘째, 스트레스 적용 초기에는 증가했던 스트레스 호르몬 수치가 감금을 해제하는 동시에 기준치(baseline)로 급격히 떨어지던 것이 스트레스 적용기간이 길어질수록 18시간 이상 높은 수치를 유지하는 것으로 보아[26], 만성 스트레스는 호르몬의 수치의 일변화가 없어지면서 일정 수준을 지속적으로 유지할 것으로 보인다. 그러나 본 연구에서는 코르티코스테론을 시간 간격을 두고 주기적으로 측정하지 않았고 8주와 16주에 각각 횡단적으로 측정하였기 때문에 호르몬의 일변화 주기에 변화가 있었다면 이를 단면 비교하기에 제한이 있었을 것으로 여겨진다.

여러 임상연구에서 스트레스는 비만의 원인 중 하나인 것으로 주목되어왔다. 체내 코티솔의 과다분비에 의한 쿠싱증후군 환자의 증상에서와 마찬가지로 코티솔의 증가는 포도당신합성(gluconeogenesis)와 지질분해를 유도하고, 렙틴 저항성을 증가시켜 체중의 증가와 고열량 음식에 더 탐닉하게 하는 행동 변화를 일으킨다[27]. 그러나 사람의 경우와는 다르게 본 연구 결과는 스트레스 적용이 렙틴 수치가 증가하고 식이효율이 떨어졌음에도 불구하고 체중과 혈중 지표들이 감소하는 것으로 나타나 스트레스의 적용 방법이나 기간이 적합하지 않았을 가능성을 보여주고 있다. 이는 지방 조직과 간의 대사 관련 유전자들의 유의한 변화가 보이지 않고 오히려 지방산의 베타 산화를 촉진하는 결과와 일치하고 있다. 아울러 스트레스를 적용한 생쥐들의 생체시계 유전자 발현이 45% 고지방식이를 준 생쥐들의 수치에 비하여 감소한 것은 지방합성이 줄고 소모가 늘어남에 따라 생체지표들이 오히려 개선되는 것과 연관성이 있는 것으로 보인다.

당대사와 지방대사가 말초 생체시계 유전자의 조절에 어떤 기전으로 작용하는지는 아직까지 잘 알려져있지 않다. 무엇보다 대사에 관여하는 장기들에 단일 세포수준의 말초 생체시계 유전자들이 존재하며 수면-각성 주기와는 별개로 조직 및 기관 별 특이적인 생체리듬을 생성할 것이라는 개념이 최근에 대두하였기 때문에 현재까지는 생체시계 유전자 조작을 이용하거나 수면-각성 주기를 교란시킨 후 생리적 변화를 관찰하는 연구들이 대부분을 차지하고 있다. 이를 뒷받침하는 기전은 생체시계를 조절하는 CLOCK, BMAL1이 전사인자(transcription factor)이며 CRY, PER 등이 조절을 받는 하위 유전자들이므로 지방생성에 관여하는 sterol regulatory element-binding protein (SREBP) 나 CCAAT-enhancer-binding proteins (C/EBPs) 등이 표적유전자로서 생체시계의 조절을 받는 것으로 설명하고 있다[28]. 그러나 본 연구처럼 고지방식이 등을 통해 비만을 유도하였을 때에도 생체시계 유전자의 변화가 일어나는 연구결과도 있어[29] 상호적인 조절이 일어나는 것으로 보인다. 아직까지 말초 생체시계 유전자의 상위 신호전달체계가 확실히 알려진 것이 없으나 일부 연구에서 에너지 항상성을 조절하는 AMP-activated protein kinase (AMPK)의 활성이 PPARs 과 같이 대사에 관여하는 주요 전사인자의 활성을 유도하고 이들의 표적 유전자로 생체시계 유전자들의 발현이 일어나는 것으로 보고되고 있다[6]. 그러나 이를 지지하는 연구들이 소수이므로 정확한 기전을 규명하기 위한 추가적인 연구가 필요할 것이다.

결론

본 연구는 45%와 60%의 고지방식이를 섭취한 마우스 모델을 이용하여 지방 함유량과 식이 기간에 따른 마우스의 체중, 섭식, 혈중 생화학 지표와 함께 대사와 관련된 유전자 발현이 증가하고 지방, 간 조직의 말초 생체시계 유전자 발현을 유도하는 것을 확인하였다. 45%의 고지방식이를 섭취한 마우스에게 16주간 장기적으로 부동 스트레스를 적용한 경우 스트레스 호르몬의 변화는 유의하지 않았으며 지방조직의 지방합성 유전자가 감소하고 간조직의 지방산 베타 산화 효소 유전자 발현이 증가하면서 혈당과 혈중 지질 수치가 감소하는 결과를 보였다. 고지방식이와 부동 스트레스의 적용은 말초 조직의 생체시계 유전자의 발현을 변화시키므로 추후 생체시계에 의한 대사작용의 조절의 이해는 비만 관련 질병의 발생이나 수면 양상이나 식이의 변화를 유발하는 행동에 대한 임상연구에 활용될 수 있을 것이다.

References

1 

H Jang G Lee J Kong G Choi YJ Park JB Kim Feeding period restriction alters the expression of peripheral circadian rhythm genes without changing body weight in micePloS One2012711e49993https://doi.org/10.1371/journal.pone.004999323166806PMC3499481

2 

J Husse SC Hintze G Eichele H Lehnert H Oster Circadian Clock genes Per1 and Per2 regulate the response of metabolism-associated transcripts to sleep disruptionPloS One2012712e52983https://doi.org/10.1371/journal.pone.005298323285241PMC3532432

3 

JA Mohawk CB Green JS Takahashi Central and peripheral circadian Clock s in mammalsAnnual Review of Neuroscience201235445462https://doi.org/10.1146/annurev-neuro-060909-15312822483041PMC3710582

4 

FW Turek C Joshu A Kohsaka E Lin G Ivanova E McDearmon Obesity and metabolic syndrome in circadian Clock mutant miceScience2005308572410431045https://doi.org/10.1126/science.110875015845877PMC3764501

5 

N Park S Cheon GH Son S Cho K Kim Chronic circadian disturbance by a shortened light-dark cycle increases mortalityNeurobiology of Aging20123361122e1122https://doi.org/10.1016/j.neurobiolaging.2011.11.00522154820

6 

O Froy Circadian rhythms and obesity in mammalsISRN Obesity20122012437198https://doi.org/10.5402/2012/437198

7 

E Maury KM Ramsey J Bass Circadian rhythms and metabolic syndrome: from experimental genetics to human diseaseCirculation Research20101063447462https://doi.org/10.1161/CIRCRESAHA.109.20835520167942PMC2837358

8 

E Charmandari C Tsigos G Chrousos Endocrinology of the stress responseAnnual Review of Physiology200567259284https://doi.org/10.1146/annurev.physiol.67.040403.12081615709959

9 

CY Wang JK Liao A mouse model of diet-induced obesity and insulin resistanceMethods in Molecular Biology2012821421433https://doi.org/10.1007/978-1-61779-430-8_2722125082PMC3807094

10 

PH Thaker LY Han AA Kamat JM Arevalo R Takahashi C Lu Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinomaNature Medicine2006128939944https://doi.org/10.1038/nm144716862152

11 

S Lopez-Varela FJ Sanchez-Muniz C Cuesta Decreased food efficiency ratio, growth retardation and changes in liver fatty acid composition in rats consuming thermally oxidized and polymerized sunflower oil used for fryingFood and Chemical Toxicology1995333181189https://doi.org/10.1016/0278-6915(94)00133-97896227

12 

P Dandona A Aljada A Bandyopadhyay Inflammation: the link between insulin resistance, obesity and diabetesTrends in Immunology200425147https://doi.org/10.1016/j.it.2003.10.01314698276

13 

X Wang J Xue J Yang M Xie Timed high-fat diet in the evening affects the hepatic circadian Clock and PPARalpha-mediated lipogenic gene expressions in miceGenes & Nutrition201385457463https://doi.org/10.1007/s12263-013-0333-y23417480PMC3755129

14 

J Jou SS Choi AM Diehl Mechanisms of disease progression in nonalcoholic fatty liver diseaseSeminars in Liver Disease2008284370379https://doi.org/10.1055/s-0028-1091981

15 

C Postic J Girard Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered miceJournal of Clinical Investigation20081183829838https://doi.org/10.1172/JCI3427518317565PMC2254980

16 

N Yahagi H Shimano AH Hasty T Matsuzaka T Ide T Yoshikawa Absence of sterol regulatory element-binding protein-1 (SREBP-1) ameliorates fatty livers but not obesity or insulin resistance in Lep (ob)/ Lep (ob) miceJournal of Biological Chemistry2002277221935319357https://doi.org/10.1074/jbc.M20158420011923308

17 

E Kathirvel K Morgan SW French TR Morgan Overexpression of liver-specific cytochrome P4502E1 impairs hepatic insulin signaling in a transgenic mouse model of nonalcoholic fatty liver diseaseEuropean Journal of Gastroenterology & Hepatology2009219973983https://doi.org/10.1097/MEG.0b013e328328f46119307976

18 

C Toda S Diano Mitochondrial UCP2 in the central regulation of metabolismBest Practice & Research Clinical Endocrinology & Metabolism2014285757764https://doi.org/10.1016/j.beem.2014.02.00625256770

19 

N Sainz J Barrenetxe MJ Moreno-Aliaga JA Martinez Lep tin resistance and diet-induced obesity: central and peripheral actions of Lep tinMetabolism20156413546https://doi.org/10.1016/j.metabol.2014.10.01525497342

20 

RB Harris Direct and indirect effects of Lep tin on adipocyte metabolismBiochimica et Biophysica Acta201418423414423https://doi.org/10.1016/j.bbadis.2013.05.00923685313PMC3838442

21 

RC Andrews O Rooyackers BR Walker Effects of the 11 beta-hydroxysteroid dehydrogenase inhibitor carbenoxolone on insulin sensitivity in men with type 2 diabetesThe Journal of Clinical Endocrinology and Metabolism2003881285291https://doi.org/10.1210/jc.2002-02119412519867

22 

MF Gregor GS Hotamisligil Inflammatory mechanisms in obesityAnnual Review of Immunology201129415445https://doi.org/10.1146/annurev-immunol-031210-10132221219177

23 

N Houstis ED Rosen ES Lander Reactive oxygen species have a causal role in multiple forms of insulin resistanceNature20064407086944948https://doi.org/10.1038/nature0463416612386

24 

H Miao Y Zhang Z Lu Q Liu L Gan FOXO1 involvement in insulin resistance-related pro-inflammatory cytokine production in hepatocytesInflammation Research2012614349358https://doi.org/10.1007/s00011-011-0417-322223069

25 

DJ Kennaway TJ Varcoe A Voultsios MJ Boden Global loss of BMAL1 expression alters adipose tissue hormones, gene expression and glucose metabolismPloS One201386e65255https://doi.org/10.1371/journal.pone.006525523750248PMC3672145

26 

JL Voorhees AJ Tarr ES Wohleb JP Godbout X Mo JF Sheridan Prolonged restraint stress increases IL-6 reduces IL-10, and causes persistent depressive-like behavior that is reversed by recombinant IL-10PloS One201383e58488https://doi.org/10.1371/journal.pone.005848823520517PMC3592793

27 

B Foss SM Dyrstad Stress in obesity: cause or consequence?Medical hypotheses2011771710https://doi.org/10.1016/j.mehy.2011.03.01121444159

28 

D Ma S Li MM Molusky JD Lin Circadian autophagy rhythm: a link between Clock and metabolism?Trends in Endocrinology and Metabolism2012237319325https://doi.org/10.1016/j.tem.2012.03.00422520961PMC3389582

29 

A Kohsaka AD Laposky KM Ramsey C Estrada C Joshu Y Kobayashi High-fat diet disrupts behavioral and molecular circadian rhythms in miceCell Metabolism200765414421https://doi.org/10.1016/j.cmet.2007.09.00617983587



This display is generated from NISO JATS XML with jats-html.xsl. The XSLT engine is libxslt.

Journal Archive

19 Volumes, 4 Issues, 433 Articles








show all


Tag Cloud

human glioma 시설노인 short messaging serves Education Emergency Nutrients

Korean Society of Biological Nursing Science (Stay Connected)
Department of Clinical Nursing, University of Ulsan, 88, Olympic-ro 43-gil, Songpa-gu, Seoul, KR 05505, Republic of Korea
Tel : +82-2-3010-5311 (Contact JKBNS Customer care: bionursing@naver.com) http://www.bionursing.or.kr/
Copyright JKBNS. All Rights Reserved.
Design by Hakjisa Pub.